metabolite is one of those subjects where the details matter more than the headlines. This page pulls together the background, the mechanisms, and the practical points readers ask about most.
Updated 2025-10-15. Numbers and descriptions here follow the published literature rather than marketing material.
The pharmacological interest in cardarine centers on PPARδ activation and its downstream effects on lipid handling and mitochondrial function. In animal studies, PPARδ agonists have been associated with changes in exercise endurance and fatty acid utilization, though results vary by model and protocol. Human data remain sparse, and the absence of large controlled trials limits conclusions about efficacy. Researchers often describe the compound as a tool for probing PPARδ biology rather than a proven therapeutic agent.
Safety discussions about cardarine frequently cite rodent carcinogenicity findings reported in the 2000s. In those studies, treated animals developed tumors at multiple sites, leading sponsors to discontinue clinical development. The relevance of these findings to humans has not been resolved, but they are a major reason the compound is not approved. Current literature emphasizes uncertainty about long-term effects and the risks of unregulated use. Regulators and health agencies have not established a safe human exposure level.
Cardarine is a synthetic compound also known as GW501516, GW-501516, and sometimes endurobol. It was developed as a selective agonist of peroxisome proliferator-activated receptor delta, a nuclear receptor involved in fatty acid oxidation and energy metabolism. The compound was studied in preclinical models for metabolic and cardiovascular conditions, but it did not become a marketed human medicine. In regulatory and anti-doping contexts, it is treated as a prohibited substance rather than a licensed medicine.
GW501516 acts as a ligand for PPAR delta, a nuclear receptor that regulates transcription of genes involved in fatty acid oxidation and energy use. Activation of this receptor in skeletal muscle shifts metabolism toward fat burning in animal models. The compound does not burn fat directly; it changes gene expression over hours to days. Researchers study it to understand metabolic flexibility and exercise adaptation. Effects observed in rodents are not automatically expected in humans.
Preclinical research reported that GW501516 increased running endurance in mice and improved lipid profiles in some animal species. Early human trials explored effects on high-density lipoprotein cholesterol, triglycerides, and glucose handling, but the program was discontinued. Published human data are sparse and do not establish efficacy for any condition. Studies also examined PPAR delta in cancer biology, with conflicting findings across models. The relationship between receptor activation, tissue context, and disease risk remains an active area of investigation.
Anti-doping laboratories identify GW501516 and its metabolites using liquid chromatography-tandem mass spectrometry. Urine is the usual matrix, and detection can occur after the parent compound has cleared from blood. The exact detection window depends on dose, formulation, individual metabolism, and assay sensitivity. Because the compound is prohibited at all times, athletes are subject to testing in and out of competition. Analytical methods continue to improve as new metabolites and designer analogs are characterized.
| Property | Value | Notes |
|---|---|---|
| Common synonyms | GW501516, GW-501516, GW 501516, endurobol | Names vary in research and anti-doping documents. |
| Chemical class | Synthetic PPARδ agonist | Small-molecule nuclear receptor ligand. |
| CAS Registry Number | 317318-70-0 | Identifier commonly associated with GW501516. |
| Appearance | White to off-white powder | Typical for purified research material. |
| Solubility | Low in water; soluble in DMSO and ethanol | Organic solvents are common for laboratory stock solutions. |
Cardarine has no approved therapeutic indication and is not marketed as a medicine. The World Anti-Doping Agency lists GW501516 as a prohibited substance at all times, covering both in-competition and out-of-competition periods. National laws vary: some countries treat it as an unapproved drug subject to import controls, while others have specific restrictions on sale for human consumption. It is often sold as a research chemical, a label that does not imply safety or legality. Enforcement actions have targeted online vendors and shipments.
Anti-doping laboratories identify GW501516 and related metabolites using liquid chromatography coupled with tandem mass spectrometry. Urine is the most common matrix, though blood and dried blood spots may also be analyzed. The method targets the parent compound and phase I and phase II metabolites, which extend the detection window. Because the substance is prohibited at all times, athletes can be tested outside competition. Detection limits and windows depend on the assay, sample type, and individual metabolism.
Cardarine is frequently described as a fat-burning or endurance-enhancing supplement, but these claims exceed the available evidence. The compound is not a hormone, steroid, or selective androgen receptor modulator. Research articles discuss it as a tool compound for studying PPARδ biology, while anti-doping literature focuses on its abuse and detection. Quality of unapproved products is uncertain, and independent analyses have found impurities or incorrect labeling. Open questions include whether human cancer risk resembles that seen in rodents and how often non-athletes use the substance.
Sporting authorities added GW501516 to prohibited lists after it appeared in athlete samples and online markets. The World Anti-Doping Agency classifies it as a hormone and metabolic modulator, and its use can lead to an anti-doping rule violation. Some early laboratory work suggested effects on fatty acid oxidation and endurance-related metabolism in animals, but those findings do not establish safe or effective use in people. Reports of adverse events in humans are scarce and often anecdotal, which complicates risk assessment.
Legal status varies by country. In some places, cardarine is controlled under medicines or psychoactive substances laws; in others, it may be sold with minimal oversight as a research chemical. Customs agencies have intercepted shipments, and several national health agencies have issued warnings about products marketed for bodybuilding or performance enhancement. The lack of a standardized pharmaceutical supply means identity, purity, and contamination levels can differ widely between samples. These factors make cardarine a regulatory and public health concern rather than a conventional prescription drug.
Cardarine is a common name for GW501516, also GW-1516, a synthetic compound developed as a peroxisome proliferator-activated receptor delta (PPARδ) agonist. It belongs to a class of agents that modulate gene transcription related to lipid and energy metabolism. The compound was studied in preclinical and early clinical research for metabolic and cardiovascular conditions, but it did not progress to approved therapeutic use. Its name appears in fitness and sports contexts despite not being approved as a drug.
PPARδ is a nuclear receptor that influences transcription of genes involved in fatty acid oxidation, lipid transport, and energy homeostasis. GW501516 binds and activates this receptor with high selectivity relative to PPARα and PPARγ in laboratory assays. Activation alters expression of target genes in skeletal muscle, liver, and adipose tissue in animal models. The exact clinical consequences of these changes in humans remain incompletely characterized, and observed effects in animals do not establish therapeutic benefit or safety.
Published studies have examined GW501516 in animal models of obesity, insulin resistance, and exercise endurance. Early human trials reportedly ended, and development was discontinued after preclinical findings raised concerns about cancer in some rodent studies. Regulatory agencies have not approved cardarine for any medical use. Its availability through non-pharmaceutical channels raises questions about identity, purity, and legal status that are separate from its laboratory pharmacology. Those questions are often addressed through analytical testing rather than assumptions about product labels.
In 2014, when Russia-United States and Russia-NATO relations worsened over the Annexation of Crimea, the Russian state-owned television channel Russia 1 stated that "Russia is the only country in the world that is really capable of turning the USA into radioactive ash." U.S. Secretary of Defense Ash Carter considered proposing deployment of ground-launched cruise missiles in Europe that could pre-emptively destroy Russian weapons. In August 2017, North Korea warned that it might launch mid-range ballistic missiles into waters within 18 to 24 miles (29 to 39 km) of Guam, following an exchange of threats between the governments of North Korea and the United States. Escalating tensions between North Korea and the United States, including threats by both countries that they could use nuclear weapons against one another, prompted a heightened state of readiness in Hawaii. The perceived ballistic missile threat broadcast all over Hawaii on 13 January 2018 was a false missile alarm. In October 2018, the former Soviet leader Mikhail Gorbachev commented that U.S. withdrawal from the Intermediate-Range Nuclear Forces Treaty is "not the work of a great mind" and that "a new arms race has been announced". In early 2019, more than 90% of world's 13,865 nuclear weapons were owned by Russia and the United States. In 2019, Vladimir Putin warned that Russia would deploy nuclear missiles in Europe if the United States deployed intermediate-range nuclear missiles there.
=== Location === Lower Saxony has a natural boundary in the north in the North Sea and the lower and middle reaches of the River Elbe, although parts of the city of Hamburg lie south of the Elbe. The state and city of Bremen is an enclave entirely surrounded by Lower Saxony. The Bremen/Oldenburg Metropolitan Region is a cooperative body for the enclave area. To the southeast, the state border runs through the Harz, low mountains that are part of the German Central Uplands. The northeast and west of the state, which form roughly three-quarters of its land area, belong to the North German Plain, while the south is in the Lower Saxon Hills, including the Weser Uplands, Leine Uplands, Schaumburg Land, Brunswick Land, Untereichsfeld, Elm, and Lappwald. In the northeast of Lower Saxony is the Lüneburg Heath. The heath is dominated by the poor, sandy soils of the geest, while in the central-east and southeast in the loess börde zone, productive soils with high natural fertility occur. Under these conditions—with loam and sand-containing soils—the land is well-developed agriculturally. In the west lie the County of Bentheim, Osnabrück Land, Emsland, Oldenburg Land, Ammerland, Oldenburg Münsterland, and on the coast East Frisia.
In addition, cysteine, tyrosine, and arginine are considered semiessential amino acids, and taurine a semi-essential aminosulfonic acid in children. Some amino acids are conditionally essential for certain ages or medical conditions. Essential amino acids may also vary from species to species. The metabolic pathways that synthesize these monomers are not fully developed. Amino acids are sometimes added to animal feed because some of the components of these feeds, such as soybeans, have low levels of some of the essential amino acids, especially of lysine, methionine, threonine, and tryptophan. Likewise amino acids are used to chelate metal cations in order to improve the absorption of minerals from feed supplements.
Sources: en.wikipedia.org
In July 2020, BK announced it would begin selling a Whopper patty made from cows on a low methane diet. In late 2021 and early 2022, the company announced it would cut back on value items and altered product configuration because of inflationary pressures and to speed up drive-thru lanes. After successfully testing vegan products at meat-free temporary restaurants in Leicester Square and Bristol, Burger King UK announced that in 2023 it would offer a Vegan Royale Bakon King, made with vegan bacon, vegan cheese and a vegan burger made by The Vegetarian Butcher.
==== Transformation of kerogen into fossil fuels ==== Kerogen formation continued to a depth of about 1 km from the Earth's surface where temperatures may reach around 50 °C. Kerogen formation represents a halfway point between organic matter and fossil fuels: kerogen can be exposed to oxygen, oxidize and thus be lost, or it could be buried deeper inside the Earth's crust and be subjected to conditions which allow it to slowly transform into fossil fuels like petroleum. The latter happened through catagenesis in which the reactions were mostly radical rearrangements of kerogen. These reactions took thousands to millions of years, and no external reactants were involved. Due to the radical nature of these reactions, kerogen reacted towards two classes of products: those with low H/C ratio (anthracene or products similar to it) and those with high H/C ratio (methane or products similar to it); i.e., carbon-rich or hydrogen-rich products. Because catagenesis was closed off from external reactants, the resulting composition of the fuel mixture was dependent on the composition of the kerogen via reaction stoichiometry. Three types of kerogen exist: type I (algal), II (liptinic) and III (humic), which were formed mainly from algae, plankton and woody plants (this term includes trees, shrubs and lianas) respectively.
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
Sources: en.wikipedia.org
Cardarine is an investigational synthetic compound that acts as a PPARδ agonist. It is also known as GW501516 and has been studied mainly in preclinical research. It is not an approved medicine.
No. Cardarine is not a steroid hormone; it targets the nuclear receptor PPARδ. Its classification in anti-doping rules differs from anabolic steroids, though it remains prohibited in sport.
Early rodent studies reported tumor formation at multiple sites, which raised safety concerns. Sponsors stopped clinical development, and no approved human product exists.
It binds to and activates PPAR delta, a nuclear receptor that controls expression of genes related to fatty acid oxidation. This mechanism can alter energy metabolism in animal models. It is not a direct stimulant or fat-burning enzyme.